ID: 1061774461_1061774465

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1061774461 1061774465
Species Human (GRCh38) Human (GRCh38)
Location 9:132951646-132951668 9:132951696-132951718
Sequence CCTCTCCTCACAGGTTTCAGATC TGTCCAGCTCCTCCTCTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!