ID: 1061790424_1061790430

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1061790424 1061790430
Species Human (GRCh38) Human (GRCh38)
Location 9:133056131-133056153 9:133056161-133056183
Sequence CCCGTGGGACCCAGGGACCAAAG TGAACTCTTCCACTTCACGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 205} {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!