ID: 1061790427_1061790432

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1061790427 1061790432
Species Human (GRCh38) Human (GRCh38)
Location 9:133056140-133056162 9:133056174-133056196
Sequence CCCAGGGACCAAAGCGGTCTCTG TTCACGTCGGCCTTCATCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97} {0: 1, 1: 0, 2: 2, 3: 4, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!