ID: 1061791527_1061791534

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1061791527 1061791534
Species Human (GRCh38) Human (GRCh38)
Location 9:133061648-133061670 9:133061668-133061690
Sequence CCCCTTTGGGGACCTAGGGGACA ACAAGCAGGGCATGGAGACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 127} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!