ID: 1061835343_1061835346

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1061835343 1061835346
Species Human (GRCh38) Human (GRCh38)
Location 9:133325057-133325079 9:133325071-133325093
Sequence CCTCAGAAGAAACCAACCCTGCT AACCCTGCTGATGTCTGGACTGG
Strand - +
Off-target summary {0: 60, 1: 326, 2: 872, 3: 1542, 4: 2244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!