ID: 1061863417_1061863427

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1061863417 1061863427
Species Human (GRCh38) Human (GRCh38)
Location 9:133479193-133479215 9:133479236-133479258
Sequence CCGGCCAATGGGGCGGCCGCAGG GGACCCGGCTTCCCCGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112} {0: 1, 1: 0, 2: 0, 3: 16, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!