ID: 1061863428_1061863435

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1061863428 1061863435
Species Human (GRCh38) Human (GRCh38)
Location 9:133479239-133479261 9:133479261-133479283
Sequence CCCGGCTTCCCCGGGCGCGGCCG GGCACCGCGTGCGCCCCCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 227} {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!