ID: 1061979150_1061979161

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1061979150 1061979161
Species Human (GRCh38) Human (GRCh38)
Location 9:134090186-134090208 9:134090231-134090253
Sequence CCCGGGGGCATAACCACTCGGCT ACAAGGTTGTGCATACACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 50} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!