ID: 1062046924_1062046933

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1062046924 1062046933
Species Human (GRCh38) Human (GRCh38)
Location 9:134428619-134428641 9:134428651-134428673
Sequence CCCTGGGAATCCCCCCGAAAGAG CTCACGCACCTGCCTTCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 1863} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!