ID: 1062105762_1062105774

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1062105762 1062105774
Species Human (GRCh38) Human (GRCh38)
Location 9:134753940-134753962 9:134753993-134754015
Sequence CCTCCCGTTCTCCGGCGGCAGCG CATGTTTTCAAGGAAATTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65} {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!