ID: 1062108571_1062108576

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1062108571 1062108576
Species Human (GRCh38) Human (GRCh38)
Location 9:134769289-134769311 9:134769311-134769333
Sequence CCCACATCACAAACTGCCCTTTC CTTGGTCAGAAGAAGCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!