ID: 1062128764_1062128768

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1062128764 1062128768
Species Human (GRCh38) Human (GRCh38)
Location 9:134881245-134881267 9:134881280-134881302
Sequence CCAGCTGGGTAGACACCAGTCAG GGTCGCCATCACAGAGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 123} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!