ID: 1062166923_1062166934

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1062166923 1062166934
Species Human (GRCh38) Human (GRCh38)
Location 9:135112582-135112604 9:135112632-135112654
Sequence CCAGCCATGCACACCTGCTTTCA CCCGTCCACCCAGTCCGCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!