ID: 1062218665_1062218680 |
View in Genome Browser |
Spacer: 10 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1062218665 | 1062218680 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 9:135402862-135402884 | 9:135402895-135402917 |
Sequence | CCTCCTCCAGCCTCCATCAGCCC | CCACCGAGGGCCCTGGGGCCAGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 1, 2: 2, 3: 54, 4: 466} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |