ID: 1062219093_1062219099

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1062219093 1062219099
Species Human (GRCh38) Human (GRCh38)
Location 9:135404705-135404727 9:135404731-135404753
Sequence CCCTCCACTCCCTGGGGATTTGT CTCAAGAGCTTCCCTTCTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 17, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!