ID: 1062261507_1062261531

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1062261507 1062261531
Species Human (GRCh38) Human (GRCh38)
Location 9:135665370-135665392 9:135665423-135665445
Sequence CCCCTCTGACCCCCTCGGGGACC GGCGGAGGAGGGTCTCGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137} {0: 1, 1: 0, 2: 1, 3: 14, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!