ID: 1062280054_1062280061

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1062280054 1062280061
Species Human (GRCh38) Human (GRCh38)
Location 9:135747788-135747810 9:135747805-135747827
Sequence CCCACTGCCTGGCCCCAGGAGCC GGAGCCCTGAGTATGCCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 480} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!