ID: 1062280055_1062280061

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1062280055 1062280061
Species Human (GRCh38) Human (GRCh38)
Location 9:135747789-135747811 9:135747805-135747827
Sequence CCACTGCCTGGCCCCAGGAGCCC GGAGCCCTGAGTATGCCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 93, 4: 805} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!