ID: 1062297614_1062297621

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1062297614 1062297621
Species Human (GRCh38) Human (GRCh38)
Location 9:135841173-135841195 9:135841212-135841234
Sequence CCACCATTACTGAGGCTTGAGTA ACAGTGTAAACAAAGCCGCCAGG
Strand - +
Off-target summary {0: 377, 1: 1425, 2: 1153, 3: 673, 4: 763} {0: 32, 1: 408, 2: 637, 3: 476, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!