ID: 1062297619_1062297623

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1062297619 1062297623
Species Human (GRCh38) Human (GRCh38)
Location 9:135841207-135841229 9:135841226-135841248
Sequence CCCTCACAGTGTAAACAAAGCCG GCCGCCAGGAAGTTTAAACTGGG
Strand - +
Off-target summary {0: 69, 1: 630, 2: 464, 3: 273, 4: 179} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!