ID: 1062306249_1062306255

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1062306249 1062306255
Species Human (GRCh38) Human (GRCh38)
Location 9:135908254-135908276 9:135908289-135908311
Sequence CCCGCGCTGGGCTGAGAATTACG GAGTTTGCATTCCGAGGATTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!