ID: 1062353227_1062353241

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1062353227 1062353241
Species Human (GRCh38) Human (GRCh38)
Location 9:136149182-136149204 9:136149235-136149257
Sequence CCTGTGCACTTCCCAGGCTGCAG CAGGCAGCCCCAGGCTGAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 76, 4: 578}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!