ID: 1062416814_1062416821

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1062416814 1062416821
Species Human (GRCh38) Human (GRCh38)
Location 9:136455354-136455376 9:136455394-136455416
Sequence CCAGCACATGGATATTTATGGAC TCCCCTCCATGGGCTCCTCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 28, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!