ID: 1062424932_1062424940

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1062424932 1062424940
Species Human (GRCh38) Human (GRCh38)
Location 9:136501792-136501814 9:136501844-136501866
Sequence CCCTGGGGCGGTGTGGGGGCCAT GGTGCTGCTGAGTCCACTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 150} {0: 1, 1: 0, 2: 3, 3: 21, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!