ID: 1062438270_1062438280

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1062438270 1062438280
Species Human (GRCh38) Human (GRCh38)
Location 9:136556739-136556761 9:136556781-136556803
Sequence CCCCATCTGCAGTGGGCCCAGGA CAGTGGTGGGATTGTATTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 230} {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!