ID: 1062450136_1062450143

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1062450136 1062450143
Species Human (GRCh38) Human (GRCh38)
Location 9:136611727-136611749 9:136611754-136611776
Sequence CCTGCCTCCGGTGTGGCTGCGAA GAGGGAGGAGAGAGCCAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 11, 3: 112, 4: 873}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!