ID: 1062516463_1062516475

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1062516463 1062516475
Species Human (GRCh38) Human (GRCh38)
Location 9:136939435-136939457 9:136939481-136939503
Sequence CCAGCTGGAGACCAGGAGTTGGC GGTGGCGCAGCCTCTCTCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 246} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!