ID: 1062519411_1062519419

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1062519411 1062519419
Species Human (GRCh38) Human (GRCh38)
Location 9:136951513-136951535 9:136951566-136951588
Sequence CCAAAGTGCTGGGATTATAGGCA TCTTTTAGGCAGGACCAGCATGG
Strand - +
Off-target summary {0: 10529, 1: 112818, 2: 243046, 3: 240273, 4: 210047} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!