ID: 1062519413_1062519419

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1062519413 1062519419
Species Human (GRCh38) Human (GRCh38)
Location 9:136951540-136951562 9:136951566-136951588
Sequence CCTCTGTGCCTGGCCTACTAATC TCTTTTAGGCAGGACCAGCATGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 104, 3: 1082, 4: 5800} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!