ID: 1062519414_1062519419

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1062519414 1062519419
Species Human (GRCh38) Human (GRCh38)
Location 9:136951548-136951570 9:136951566-136951588
Sequence CCTGGCCTACTAATCCTTTCTTT TCTTTTAGGCAGGACCAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 666} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!