ID: 1062562471_1062562479

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1062562471 1062562479
Species Human (GRCh38) Human (GRCh38)
Location 9:137147777-137147799 9:137147814-137147836
Sequence CCACTCAGGACTGACACAGGTTG GGGGCCACACAGCAGGTGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!