ID: 1062569235_1062569239

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1062569235 1062569239
Species Human (GRCh38) Human (GRCh38)
Location 9:137177180-137177202 9:137177212-137177234
Sequence CCAGGCTGGAGTGAAAGGAAGGC GAGCAGAGCCGCCGAGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 887} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!