ID: 1062570342_1062570347

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1062570342 1062570347
Species Human (GRCh38) Human (GRCh38)
Location 9:137182090-137182112 9:137182126-137182148
Sequence CCTGCAATCCCAGCACATAGGGA GACCTAAGCCCAGGTGTCCGAGG
Strand - +
Off-target summary {0: 2, 1: 82, 2: 8827, 3: 308303, 4: 273243} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!