ID: 1062574472_1062574491

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1062574472 1062574491
Species Human (GRCh38) Human (GRCh38)
Location 9:137199981-137200003 9:137200033-137200055
Sequence CCAGGCGGGGAGCCCGCGAGGCG CCGAGTGCCCGTTGGAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 153} {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!