ID: 1062744507_1062744513

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1062744507 1062744513
Species Human (GRCh38) Human (GRCh38)
Location 9:138202762-138202784 9:138202777-138202799
Sequence CCCCTGTCTCCAAGAAGCCCCAA AGCCCCAACATGGAAGGCTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!