ID: 1062809131_1062809136

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1062809131 1062809136
Species Human (GRCh38) Human (GRCh38)
Location 10:448668-448690 10:448685-448707
Sequence CCCTGTCGATATTCAGGATCACA ATCACACACAGTGGGGCAGCAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 7, 3: 10, 4: 59} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!