ID: 1062882178_1062882190

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1062882178 1062882190
Species Human (GRCh38) Human (GRCh38)
Location 10:988055-988077 10:988094-988116
Sequence CCCGGATCCCCTAGACCCTCTGG ACTCCCAAATCCCAAGACCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 206} {0: 1, 1: 0, 2: 3, 3: 23, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!