ID: 1062974564_1062974572

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1062974564 1062974572
Species Human (GRCh38) Human (GRCh38)
Location 10:1674067-1674089 10:1674090-1674112
Sequence CCCCTGAAGTCGATGTCAGACCT GAGGGCTGCAAGGAGGCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!