ID: 1063000727_1063000730

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1063000727 1063000730
Species Human (GRCh38) Human (GRCh38)
Location 10:1918752-1918774 10:1918776-1918798
Sequence CCTGCACTGAAACACCATAGGGC ACTAATAATATTAATTTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!