ID: 1063366280_1063366283

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1063366280 1063366283
Species Human (GRCh38) Human (GRCh38)
Location 10:5492928-5492950 10:5492945-5492967
Sequence CCCTGACAAGGAAGCTTCAGCGC CAGCGCAAGCCAGCGGCTCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!