ID: 1063576535_1063576540

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1063576535 1063576540
Species Human (GRCh38) Human (GRCh38)
Location 10:7266615-7266637 10:7266656-7266678
Sequence CCACAGGGAGGCAGGAGCAAAAG CAGTTTCAACAGAAGCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 47, 4: 392} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!