ID: 1063961508_1063961517

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1063961508 1063961517
Species Human (GRCh38) Human (GRCh38)
Location 10:11309898-11309920 10:11309924-11309946
Sequence CCCTTTGTTCTTGTGACCTGTCT CCTGCTCTGGAGGTGGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 323} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!