ID: 1064103770_1064103781

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1064103770 1064103781
Species Human (GRCh38) Human (GRCh38)
Location 10:12484580-12484602 10:12484617-12484639
Sequence CCAAGATGGTGGAAGCCAGGCAG GGAGGGTGAGCTCATTCACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 316} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!