ID: 1064153684_1064153695

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1064153684 1064153695
Species Human (GRCh38) Human (GRCh38)
Location 10:12886343-12886365 10:12886385-12886407
Sequence CCTTAGCCCAAGGCCAGAAATGG GGAGCAATTATCAGGGAGTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!