ID: 1064345257_1064345262

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1064345257 1064345262
Species Human (GRCh38) Human (GRCh38)
Location 10:14526587-14526609 10:14526627-14526649
Sequence CCTTTATCTCTAGAACTGCCCCT ACAGCAGCAAGTATTTATTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 47, 4: 964}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!