ID: 1064506753_1064506756

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1064506753 1064506756
Species Human (GRCh38) Human (GRCh38)
Location 10:16039358-16039380 10:16039378-16039400
Sequence CCAGGCATGTAATTAGCCCACAC CACCTGTAATCCCAGCTACTCGG
Strand - +
Off-target summary No data {0: 27298, 1: 77225, 2: 165100, 3: 221696, 4: 302720}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!