ID: 1064506753_1064506765

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1064506753 1064506765
Species Human (GRCh38) Human (GRCh38)
Location 10:16039358-16039380 10:16039410-16039432
Sequence CCAGGCATGTAATTAGCCCACAC GCAGGAGGATCGCTTGAACCTGG
Strand - +
Off-target summary No data {0: 660, 1: 44104, 2: 117764, 3: 154638, 4: 97659}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!