ID: 1064607518_1064607523

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1064607518 1064607523
Species Human (GRCh38) Human (GRCh38)
Location 10:17059340-17059362 10:17059369-17059391
Sequence CCCATAAAATTTGAGCCACAGAA TAAGCTGATCCTCTGGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 302} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!