ID: 1064632328_1064632335

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1064632328 1064632335
Species Human (GRCh38) Human (GRCh38)
Location 10:17329055-17329077 10:17329104-17329126
Sequence CCAGAATCATTGTGACTGCTGTC GCCCAACTAGCAAAGAAACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 186} {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!