ID: 1064731279_1064731287

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1064731279 1064731287
Species Human (GRCh38) Human (GRCh38)
Location 10:18333265-18333287 10:18333313-18333335
Sequence CCTTATCTGAAGCTGCTGAATTG AGAGGGATAAACTCTGAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!